RT-qPCR assay


Last updated:
Total hit(s): 26
Select item(s)
Key Findings
Comments
(You can add your comments too!)
Original Article
(hover to see details)
Reporting a novel nsp1 real-time RT-PCR assay for the detection of SARS-CoV-2, based on nanopore sequencing. nsp1 gene was identified as a highlyexpressed gene in all samples via Nanopore wholegenome sequencing. This assay is unique because it target the nsp1 gene which is located at the 5' end of the genome, while the other assays targets the middle or the end of the SARS-CoV-2 genome.
32501535
(J Med Virol)
PMID
32501535
Date of Publishing: 2020 Nov
Title Identification of nsp1 gene as the target of SARS-CoV-2 real time RT-PCR using nanopore whole genome sequencing
Author(s) nameChan WM, Ip JD et al.
Journal J Med Virol
Impact factor
2.07
Citation count: 5


In this study, the RT-PCR assays were conducted using three protocols, CDC, NIID, and YCH assay for the diagnosis of SARS-CoV-2. The YCH assay targets 2 sites of the N gene (YCH-N1, and YCH-N2) and utilizes double-quencher probes. The double quencher probe reduced the background signal and detected SARS-CoV-2 in the low viral load clinical specimens. The expected amplicon sizes for the YCH assays are 158 bp for the N2 genes
32650037
(J Virol Methods)
PMID
32650037
Date of Publishing: 2020 Oct
Title Double-quencher probes improve detection sensitivity toward Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) in a reverse-transcription polymerase chain reaction (RT-PCR) assay
Author(s) name Hirotsu Y, Mochizuki H, Omata M.
Journal J Virol Methods
Impact factor
1.76
Citation count: 9


In this study, the RT-PCR assays were conducted using three protocols, CDC, NIID, and YCH assay for the diagnosis of SARS-CoV-2. The NIID assay (Japan) targets 2 sites of the N gene (NIID-N1, NIID-N2) and utilizes single-quencher probes. The positive detection rate of N2 was higher than that of the N1 site. The expected amplicon sizes for the NIID are 128 bp for the N1 genes
32650037
(J Virol Methods)
PMID
32650037
Date of Publishing: 2020 Oct
Title Double-quencher probes improve detection sensitivity toward Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) in a reverse-transcription polymerase chain reaction (RT-PCR) assay
Author(s) name Hirotsu Y, Mochizuki H, Omata M.
Journal J Virol Methods
Impact factor
1.76
Citation count: 9


In this study, the RT-PCR assays were conducted using three protocols, CDC, NIID, and YCH assay for the diagnosis of SARS-CoV-2. The CDC (USA) protocol targets 3 sites of the N gene (CDC-N1, CDC-N2, CDC-N3) and utilizes single-quencher probes. The CDC-N2 assay had a limit of detection of 10 copies of the DNA positive control. The expected amplicon sizes for the CDC assay are 72, 67, and 72 bp for the N1, N2, and N3 genes, respectively
32650037
(J Virol Methods)
PMID
32650037
Date of Publishing: 2020 Oct
Title Double-quencher probes improve detection sensitivity toward Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) in a reverse-transcription polymerase chain reaction (RT-PCR) assay
Author(s) name Hirotsu Y, Mochizuki H, Omata M.
Journal J Virol Methods
Impact factor
1.76
Citation count: 9


In this study, a real-time RT-PCR assay was assessed by a sample pooling strategy. The study revealed that pooling of up to 10 samples per pool increased test capacity, with 60% of resource-saving, and detected positive samples with sufficient diagnostic accuracy. Ct values were lower in retested positive individual samples compared with pools. This approach can facilitate mass screening in the early coming stages of COVID-19 outbreaks.
One limitation of poolong is that the detection time is stretched.
32869865
(J Med Virol)
PMID
32869865
Date of Publishing: 2020 Sep 1
Title Evaluation of sample pooling for diagnosis of COVID- 19 by real-time PCR : A resource-saving combat stratergy
Author(s) nameGarg J, Singh V et al.
Journal J Med Virol
Impact factor
2.07
Citation count: 4


Reporting a one-step SYBR Green-based RT-qPCR assay specific for the E gene of SARS-CoV-2, which can be used as a lower-cost alternative to TaqMan RT-qPCR assay. The SYBR Green-based assay was able to detect all 8 dilutions of the isolate. The average Ct variation between SYBR Green and TaqMan was 1.92
32767275
(Braz J Microbiol)
PMID
32767275
Date of Publishing: 2020 Sep
Title Lower cost alternatives for molecular diagnosis of COVID-19: conventional RT-PCR and SYBR Green-based RT-qPCR
Author(s) nameDorlass EG, Monteiro CO et al.
Journal Braz J Microbiol
Impact factor
1.67
Citation count: 2


Reporting a two-step SYBR Green-based RT-qPCR assay specific for the E gene of SARS-CoV-2, which can be used as a lower-cost alternative to TaqMan RT-qPCR assay. The SYBR Green-based assay was able to detect all 8 dilutions of the isolate. The average Ct variation between SYBR Green and TaqMan was 1.92
32767275
(Braz J Microbiol)
PMID
32767275
Date of Publishing: 2020 Sep
Title Lower cost alternatives for molecular diagnosis of COVID-19: conventional RT-PCR and SYBR Green-based RT-qPCR
Author(s) nameDorlass EG, Monteiro CO et al.
Journal Braz J Microbiol
Impact factor
1.67
Citation count: 2


Comparative study of diagnosis of COVID-19 by chest CT scans and RT-PCR assay showed that chest CT scans for the primary screening of COVID-19 showed a low positive predictive value than RT-PCR assay. For chest CT scans and RT-PCR, the Positive predictive value ranged from 1.5%-30.7% and 47.3%-96.4%, respectively.
32301646
(Radiology)
PMID
32301646
Date of Publishing: 2020 Sep
Title Diagnostic Performance of CT and Reverse Transcriptase-Polymerase Chain Reaction for Coronavirus Disease 2019: A Meta-Analysis
Author(s) name Kim H, Hong H, Yoon SH.
Journal Radiology
Impact factor
7.11
Citation count: 120


Reporting a rapid, inexpensive method, Direct RT-qPCR to detect SARS-CoV-2 from all respiratory specimens by targeting the E gene. The assay had a detection rate of 95.8 % for Ct values <35. Direct RT-qPCR works well with fresh samples (storage <1 week).
32795959
(J Clin Virol)
PMID
32795959
Date of Publishing: 2020 Sep
Title Extraction-free SARS-CoV-2 detection by rapid RT-qPCR universal for all primary respiratory materials
Author(s) nameLübke N, Senff T et al.
Journal J Clin Virol
Impact factor
2.95
Citation count: 4


Reporting DIOS RT-qPCR assay, which targets two regions of nucleocapsid genes (N1, N2) to detect SARS-CoV-2. Ct value of <40, was indicative of a SARS-CoV-2-positive sample. The pre-treatment of the swab sample by heat inactivation (75 degree Celsius for 10 min) was also tested. No significant changes in heat inactivation were observed. Comparative analysis of swab samples by DIOS-RT-qPCR (directly from a swab) and an IVD CE-certified RT-qPCR kit (using extracted RNA) was performed, 98% concordance results were observed.
32824767
(Diagnostics (Basel))
PMID
32824767
Date of Publishing: 2020 Aug 18
Title Direct-RT-qPCR detection of SARS-CoV-2 without RNA extraction as part of a Covid-19 testing strategy: From sample to result in one hour
Author(s) name Kriegova E, Fillerova R, Kvapil P.
Journal Diagnostics (Basel)
Impact factor
2.36
Citation count: 3


Reporting diagnostic panel developed by US CDC consists of 3 real-time reverse transcription PCR assays specific for detecting the nucleocapsid gene of SARS-COV-2. N1 and N2 assays specifically detect SARS-CoV-2 while N3 assay detects all viruses within the subgenus Sarbecovirus
32396505
(Emerg Infect Dis)
PMID
32396505
Date of Publishing: 2020 Aug
Title US CDC Real-Time Reverse Transcription PCR Panel for detection of Severe Acute Respiratory Syndrome Coronavirus 2
Author(s) nameLu X, Wang L et al.
Journal Emerg Infect Dis
Impact factor
6.81
Citation count: 38


The implementation of real-time RT-PCR for the detection of COVID-19 based on SARS-CoV-2 nucleocapsid gene set 1 and 2.
32074516
(Jpn J Infect Dis)
PMID
32074516
Date of Publishing: 2020 Jul 22
Title Development of genetic diagnostic methods for detection for Novel Coronavirus 2019 (nCoV-2019) in Japan
Author(s) nameShirato K, Nao N et al.
Journal Jpn J Infect Dis
Impact factor
1.11
Citation count: 72


SARS-CoV-2 was detected, from feces specimens, by using the qRT-PCR method. The primers and probe of ORF1ab gene (taken from PMID- 32031570): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGCATCAGCTGA; and the probe 5-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3.
32159775
(JAMA)
PMID
32159775
Date of Publishing: 2020 May 12
Title Detection of SARS-CoV-2 in different types of clinical specimens
Author(s) nameWang W, Xu Y et al.
Journal JAMA
Impact factor
14.78
Citation count: 1133


SARS-CoV-2 was detected, from urine specimens, by using the qRT-PCR method. The primers and probe of ORF1ab gene (taken from PMID- 32031570): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGCATCAGCTGA; and the probe 5-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3.
32159775
(JAMA)
PMID
32159775
Date of Publishing: 2020 May 12
Title Detection of SARS-CoV-2 in different types of clinical specimens
Author(s) nameWang W, Xu Y et al.
Journal JAMA
Impact factor
14.78
Citation count: 1133


SARS-CoV-2 was detected, from blood specimens, by using the qRT-PCR method. The primers and probe of ORF1ab gene (taken from PMID- 32031570): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGCATCAGCTGA; and the probe 5-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3.
32159775
(JAMA)
PMID
32159775
Date of Publishing: 2020 May 12
Title Detection of SARS-CoV-2 in different types of clinical specimens
Author(s) nameWang W, Xu Y et al.
Journal JAMA
Impact factor
14.78
Citation count: 1133


SARS-CoV-2 was detected, from pharyngeal swab specimens, by using the qRT-PCR method. The primers and probe of ORF1ab gene (taken from PMID- 32031570): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGCATCAGCTGA; and the probe 5-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3.
32159775
(JAMA)
PMID
32159775
Date of Publishing: 2020 May 12
Title Detection of SARS-CoV-2 in different types of clinical specimens
Author(s) nameWang W, Xu Y et al.
Journal JAMA
Impact factor
14.78
Citation count: 1133


SARS-CoV-2 was detected, from nasal swab specimens, by using the qRT-PCR method. The primers and probe of ORF1ab gene (taken from PMID- 32031570): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGCATCAGCTGA; and the probe 5-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3.
32159775
(JAMA)
PMID
32159775
Date of Publishing: 2020 May 12
Title Detection of SARS-CoV-2 in different types of clinical specimens
Author(s) nameWang W, Xu Y et al.
Journal JAMA
Impact factor
14.78
Citation count: 1133


SARS-CoV-2 was detected, from sputum samples, by using the qRT-PCR method. The primers and probe of ORF1ab gene (taken from PMID- 32031570): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGCATCAGCTGA; and the probe 5-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3.
32159775
(JAMA)
PMID
32159775
Date of Publishing: 2020 May 12
Title Detection of SARS-CoV-2 in different types of clinical specimens
Author(s) nameWang W, Xu Y et al.
Journal JAMA
Impact factor
14.78
Citation count: 1133


SARS-CoV-2 was detected, from fibrobronchoscope brush biopsy specimens, by using the qRT-PCR method. The primers and probe of ORF1ab gene (taken from PMID- 32031570): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGCATCAGCTGA; and the probe 5-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3.
32159775
(JAMA)
PMID
32159775
Date of Publishing: 2020 May 12
Title Detection of SARS-CoV-2 in different types of clinical specimens
Author(s) nameWang W, Xu Y et al.
Journal JAMA
Impact factor
14.78
Citation count: 1133


SARS-CoV-2 was detected, from Bronchoalveolar lavage fluid samples, by using the qRT-PCR method. The primers and probe of ORF1ab gene (taken from PMID- 32031570): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGCATCAGCTGA; and the probe 5-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3.
32159775
(JAMA)
PMID
32159775
Date of Publishing: 2020 May 12
Title Detection of SARS-CoV-2 in different types of clinical specimens
Author(s) nameWang W, Xu Y et al.
Journal JAMA
Impact factor
14.78
Citation count: 1133


Reporting a RT-qPCR assay specific for ORF 1b and N gene of SARS-CoV-2 and closely related species. Phylogenetic analyses were performed for SARS coronavirus, bat SARS-like coronaviruses, and other representative coronaviruses sequences. The primers and probe sequences were designed based on Genbank (Accession number: MN908947).
32031583
(Clin Chem)
PMID
32031583
Date of Publishing: 2020 Apr 1
Title Molecular Diagnosis of a Novel Coronavirus (2019-nCoV) Causing an Outbreak of Pneumonia
Author(s) nameChu DKW, Pan Y et al.
Journal Clin Chem
Impact factor
4.75
Citation count: 259


Reporting a qPCR-based detection method specific for the detection of the receptor-binding domain of the S gene of SARS-CoV-2. Samples from oral swabs, anal swabs and blood from 2019-nCoV positive patients were found to be negative during the second sampling.
32015507
(Nature)
PMID
32015507
Date of Publishing: 2020 Mar
Title A pneumonia outbreak associated with a new coronavirus of probable bat origin
Author(s) nameZhou P, Yang XL et al.
Journal Nature
Impact factor
24.36
Citation count: 3984


Reporting RT-qPCR N gene assay which, can be used as the additional confirmatory assay for SARS-CoV-2 detection. The assay was designed and validated by 2003 SARS-CoV (GenBank NC_004718) which, showed alignment to six available sequences of 2019-nCoV
31992387
(Euro Surveill)
PMID
31992387
Date of Publishing: 2020 Jan
Title Detection of Covid 19 novel coronavirus (2019 -nCoV) by real-time RT-PCR
Author(s) nameCorman VM, Landt O et al.
Journal Euro Surveill
Impact factor
7.37
Citation count: 1206


Reporting RT-qPCR RdRP gene assay which, can be used as the confirmatory test for SARS-CoV-2 detection. The assay was designed and validated by 2003 SARS-CoV (GenBank NC_004718) which, showed alignment to six available sequences of 2019-nCoV
31992387
(Euro Surveill)
PMID
31992387
Date of Publishing: 2020 Jan
Title Detection of Covid 19 novel coronavirus (2019 -nCoV) by real-time RT-PCR
Author(s) nameCorman VM, Landt O et al.
Journal Euro Surveill
Impact factor
7.37
Citation count: 1206


Reporting RT-qPCR E gene assay which, can be used as the first-line screening test for SARS-CoV-2 detection. The assay was designed and validated by 2003 SARS-CoV (GenBank NC_004718) which, showed alignment to six available sequences of 2019-nCoV
31992387
(Euro Surveill)
PMID
31992387
Date of Publishing: 2020 Jan
Title Detection of Covid 19 novel coronavirus (2019 -nCoV) by real-time RT-PCR
Author(s) nameCorman VM, Landt O et al.
Journal Euro Surveill
Impact factor
7.37
Citation count: 1206